Review



recombinant aav2 reference standard material  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    ATCC recombinant aav2 reference standard material
    Recombinant Aav2 Reference Standard Material, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 165 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Recombinant+Adeno-associated+virus+2/pm42129193-480-16-21
    Average 95 stars, based on 165 article reviews
    recombinant aav2 reference standard material - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Cell fusion-related proteins AoHam4, AoHam8 and AoPP2A regulate hyphal fusion, conidiation, trap morphogenesis, and secondary metabolism in Arthrobotrys oligospora .
    Article Snippet: Library products were sequenced using an Illumina Novaseq X Plus. .. Raw sequencing data were further filtered by fastp (version 0.18.0) [59], and reference genomes were compared by HISAT2 2.1.0 [60] [Reference gene source: A. oligospora ATCC 24,927 (https://www. ncbi.nlm.nih.gov/assembly/GCF_000225545.1), reference genome version: AOL24927 1.0]. ..

    Virus:

    Article Title: Assessment of In Vitro Models of the Human Buccal Mucosa for Vaccine and Adjuvant Development.
    Article Snippet: To understand requirements for immunization via the oral mucosa, an in vitro model that recapitulates the physical barrier of the mouth, allows for quantification of antigen uptake and permeability and mounts an inflammatory response to antigen and adjuvant is needed.. The physical structure of 4 models of the human oral mucosa was determined by histochemical staining and transepithelial electrical resistance (TEER) measurements.. A TR146 based air−liquid interface (ALI) model most closely mimicked in vivo conditions.

    Plasmid Preparation:

    Article Title: Assessment of In Vitro Models of the Human Buccal Mucosa for Vaccine and Adjuvant Development.
    Article Snippet: To understand requirements for immunization via the oral mucosa, an in vitro model that recapitulates the physical barrier of the mouth, allows for quantification of antigen uptake and permeability and mounts an inflammatory response to antigen and adjuvant is needed.. The physical structure of 4 models of the human oral mucosa was determined by histochemical staining and transepithelial electrical resistance (TEER) measurements.. A TR146 based air−liquid interface (ALI) model most closely mimicked in vivo conditions.

    Article Title: Genomic characterization of high-level efflux pump overexpression in Pseudomonas aeruginosa clones with epidemic potential.
    Article Snippet: 1 Department of Clinical Laboratory Medicine, Taizhou Central Hospital (Taizhou University Hospital), School of Medicine, Taizhou University, Taizhou, Zhejiang 318000, China 2 School of Life Sciences, Taizhou University, Taizhou, Zhejiang 318000, China 3 Department of Central Laboratory, Taizhou Municipal Hospital (Taizhou University Affiliated Municipal Hospital), School of Medicine, Taizhou University, 381-1 Zhongshan Eastern Road, Taizhou, Zhejiang 318000, China 4 School of Basic Medicine and Medical Laboratory Science, School of Medicine, Taizhou University, 1139 Shifu Avenue, Taizhou, Zhejiang 318000, China Abstract The concerted overexpression of multiple efflux pumps in Pseudomonas aeruginosa now represents a key driver of multidrug resistance (MDR), progressively undermining the efficacy of conventional antibiotic therapies.. The transferability of plasmid pXM8-2 was assessed by conjugation experiments.. The antimicrobial susceptibility of strains P113, P118, T117, and XM8 was determined using the BioMerieux VITEK-2 system in conjunction with the disk diffusion method. β-lactamase or carbapenemase production was detected per CLSI guidelines.

    Real-time Polymerase Chain Reaction:

    Article Title: Assessment of In Vitro Models of the Human Buccal Mucosa for Vaccine and Adjuvant Development.
    Article Snippet: To understand requirements for immunization via the oral mucosa, an in vitro model that recapitulates the physical barrier of the mouth, allows for quantification of antigen uptake and permeability and mounts an inflammatory response to antigen and adjuvant is needed.. The physical structure of 4 models of the human oral mucosa was determined by histochemical staining and transepithelial electrical resistance (TEER) measurements.. A TR146 based air−liquid interface (ALI) model most closely mimicked in vivo conditions.

    Bioprocessing:

    Article Title: Assessment of In Vitro Models of the Human Buccal Mucosa for Vaccine and Adjuvant Development.
    Article Snippet: To understand requirements for immunization via the oral mucosa, an in vitro model that recapitulates the physical barrier of the mouth, allows for quantification of antigen uptake and permeability and mounts an inflammatory response to antigen and adjuvant is needed.. The physical structure of 4 models of the human oral mucosa was determined by histochemical staining and transepithelial electrical resistance (TEER) measurements.. A TR146 based air−liquid interface (ALI) model most closely mimicked in vivo conditions.

    Gene Expression:

    Article Title: Genomic characterization of high-level efflux pump overexpression in Pseudomonas aeruginosa clones with epidemic potential.
    Article Snippet: 1 Department of Clinical Laboratory Medicine, Taizhou Central Hospital (Taizhou University Hospital), School of Medicine, Taizhou University, Taizhou, Zhejiang 318000, China 2 School of Life Sciences, Taizhou University, Taizhou, Zhejiang 318000, China 3 Department of Central Laboratory, Taizhou Municipal Hospital (Taizhou University Affiliated Municipal Hospital), School of Medicine, Taizhou University, 381-1 Zhongshan Eastern Road, Taizhou, Zhejiang 318000, China 4 School of Basic Medicine and Medical Laboratory Science, School of Medicine, Taizhou University, 1139 Shifu Avenue, Taizhou, Zhejiang 318000, China Abstract The concerted overexpression of multiple efflux pumps in Pseudomonas aeruginosa now represents a key driver of multidrug resistance (MDR), progressively undermining the efficacy of conventional antibiotic therapies.. The transferability of plasmid pXM8-2 was assessed by conjugation experiments.. The antimicrobial susceptibility of strains P113, P118, T117, and XM8 was determined using the BioMerieux VITEK-2 system in conjunction with the disk diffusion method. β-lactamase or carbapenemase production was detected per CLSI guidelines.

    Over Expression:

    Article Title: Genomic characterization of high-level efflux pump overexpression in Pseudomonas aeruginosa clones with epidemic potential.
    Article Snippet: 1 Department of Clinical Laboratory Medicine, Taizhou Central Hospital (Taizhou University Hospital), School of Medicine, Taizhou University, Taizhou, Zhejiang 318000, China 2 School of Life Sciences, Taizhou University, Taizhou, Zhejiang 318000, China 3 Department of Central Laboratory, Taizhou Municipal Hospital (Taizhou University Affiliated Municipal Hospital), School of Medicine, Taizhou University, 381-1 Zhongshan Eastern Road, Taizhou, Zhejiang 318000, China 4 School of Basic Medicine and Medical Laboratory Science, School of Medicine, Taizhou University, 1139 Shifu Avenue, Taizhou, Zhejiang 318000, China Abstract The concerted overexpression of multiple efflux pumps in Pseudomonas aeruginosa now represents a key driver of multidrug resistance (MDR), progressively undermining the efficacy of conventional antibiotic therapies.. The transferability of plasmid pXM8-2 was assessed by conjugation experiments.. The antimicrobial susceptibility of strains P113, P118, T117, and XM8 was determined using the BioMerieux VITEK-2 system in conjunction with the disk diffusion method. β-lactamase or carbapenemase production was detected per CLSI guidelines.

    Membrane:

    Article Title: Genomic characterization of high-level efflux pump overexpression in Pseudomonas aeruginosa clones with epidemic potential.
    Article Snippet: 1 Department of Clinical Laboratory Medicine, Taizhou Central Hospital (Taizhou University Hospital), School of Medicine, Taizhou University, Taizhou, Zhejiang 318000, China 2 School of Life Sciences, Taizhou University, Taizhou, Zhejiang 318000, China 3 Department of Central Laboratory, Taizhou Municipal Hospital (Taizhou University Affiliated Municipal Hospital), School of Medicine, Taizhou University, 381-1 Zhongshan Eastern Road, Taizhou, Zhejiang 318000, China 4 School of Basic Medicine and Medical Laboratory Science, School of Medicine, Taizhou University, 1139 Shifu Avenue, Taizhou, Zhejiang 318000, China Abstract The concerted overexpression of multiple efflux pumps in Pseudomonas aeruginosa now represents a key driver of multidrug resistance (MDR), progressively undermining the efficacy of conventional antibiotic therapies.. The transferability of plasmid pXM8-2 was assessed by conjugation experiments.. The antimicrobial susceptibility of strains P113, P118, T117, and XM8 was determined using the BioMerieux VITEK-2 system in conjunction with the disk diffusion method. β-lactamase or carbapenemase production was detected per CLSI guidelines.

    Recombinant:

    Article Title: Engineering B cells to express fully customizable antibodies with enhanced Fc functions.
    Article Snippet: AAV vector AR TI CL E IN P RE SS genome (vg) titers were determined by TaqMan qPCR (Thermo Fisher) using ITR specific forward primer (5’-GAACCCCTAGTGATGGAGTT-3'), reverse primer (5’-CGGCCTCAGTGAGCGA-3'), and probe (5’-FAM-CACTCCCTCTCTGCGCGCTCG-Tamra-3’). .. To prepare the standard curve, serial dilutions of DNA extracted at the same time from a recombinant AAV2 Reference Standard Material (American Type Culture Collection; VR-1616) was used57. ..

    Amplification:

    Article Title: Clinical profiling of skin microbiome and metabolome during re-epithelialization
    Article Snippet: .. Analyzed Strains Reference strains Primers/probe Amplicon size Staphylococcus epidermidis ATCC 12228D-5 PCI 1200 SodA gene Forward 5’ TTTAGAAGCTAAATCAATCGAAGAAA 3’ Reverse 5’ GGTGACCACCGCCATTATTA 3’ Probe 5’ TGCCATCTAATATTCAAACAGCTGT 3’ (FAM) 95 bp Cutibacterium acnes ATCC 6919 NCTC 737 Lipase/acylhydrolase gene Forward 5’ GTGTCGAGGTCGAAGTCGTT 3’ Reverse 5’ GTGAAGGCTGCTGTGCATAA 3’ Probe 5’ AGCCTTCGCGTTATTGGACTC 3’ (HEX) 149 pb Malassezia resticta ATCC MYA-4611D-5 CBS 7877 5.8S rRNA gene Forward 5’ GGCGGCCAAGCAGTGTTT 3’ Reverse 5’ AACCAAACATTCCTCCTTTAGGTGA 3’ Probe 5’ TTCTCCTGGCATGGCAT 3’ (HEX) 89 pb Malassezia globosa ATCC MYA-4612D-5 CBS 7966 5.8S rRNA gene Forward 5’ GGCCAAGCGCGCTCT 3’ Reverse 5’ CCACAACCAAATGCTCTCCTACAG 3’ Probe 5’ ATCATCAGGCATAGCATG 3’ (FAM) 75 pb ..

    Control:

    Article Title: Precise kilobase-scale genomic insertions in mammalian cells using PASTE
    Article Snippet: Titer Calculation (1 or 10 days): Measure physical titer (AdV genomes/mL) using a quantitative PCR kit with viral DNA specific primers, such as the Takara Adeno-X qPCR Titration Kit. .. Use Ad5 reference material (ATCC#VR-1516) as an internal control for assay validation. ..

    Biomarker Discovery:

    Article Title: Precise kilobase-scale genomic insertions in mammalian cells using PASTE
    Article Snippet: Titer Calculation (1 or 10 days): Measure physical titer (AdV genomes/mL) using a quantitative PCR kit with viral DNA specific primers, such as the Takara Adeno-X qPCR Titration Kit. .. Use Ad5 reference material (ATCC#VR-1516) as an internal control for assay validation. ..



    Similar Products

    95
    ATCC recombinant aav2 reference standard material
    Recombinant Aav2 Reference Standard Material, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Recombinant+Adeno-associated+virus+2/pm42129193-480-16-21
    Average 95 stars, based on 1 article reviews
    recombinant aav2 reference standard material - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    86
    Ethicon reference materials commercial bone wax
    Reference Materials Commercial Bone Wax, supplied by Ethicon, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/bone+wax/10__1016_slash_j__matdes__2026__116224-55-0-6
    Average 86 stars, based on 1 article reviews
    reference materials commercial bone wax - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    National Research Council Canada certified reference material
    Certified Reference Material, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Fish+Protein+Certified+Reference+Material/pmc13079512-72-17-27
    Average 96 stars, based on 1 article reviews
    certified reference material - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    91
    Croda International Plc reference materials
    Reference Materials, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Brain+Extract+Total/pm41999695-323-18-26
    Average 91 stars, based on 1 article reviews
    reference materials - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    95
    National Research Council Canada certified reference materials crms slrs 6
    Certified Reference Materials Crms Slrs 6, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/River+water+-+Trace+elements/pm41980390-118-15-29
    Average 95 stars, based on 1 article reviews
    certified reference materials crms slrs 6 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    National Research Council Canada nass 7
    Nass 7, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Seawater+certified+reference+material+for+trace+metals+and+other+constituents/pm41980390-118-21-29
    Average 93 stars, based on 1 article reviews
    nass 7 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    ATCC atcc reference material
    Atcc Reference Material, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/Human+respiratory+syncytial+virus+A/med_rxiv__64898__2026__04__06__26350258-65-16-19
    Average 94 stars, based on 1 article reviews
    atcc reference material - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    National Research Council Canada elemental chromium
    Elemental Chromium, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reference+material/High+Purity+Lead+Certified+Reference+Material+for+Lead+Mass+Fraction%2C+Atomic+Weight%2C+Isotopic+Composition%2C+and+Elemental+Impurities/10__1016_slash_j__anifeedsci__2026__116776-39-14-27
    Average 93 stars, based on 1 article reviews
    elemental chromium - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results